Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Home > Science & Mathematics > Biology, life sciences > Microbiology (non-medical) > Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation

Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation


     0     
5
4
3
2
1



International Edition


About the Book

Helper T cells activate a set of lymphokine genes upon recognition of antigens presented in the context of the major histocompatibility complex on antigen presenting cells (Arai et al., 1986; Miyajima et al., 1988). Activation of T cells proceeds in two distinct stages. The flrst step is triggered by binding of an antigen to the T cell antigen receptor/CD3 complex that leads to the activation of protein kinase C (PKC) and an increase in intracellular Ca2+. This step, which is substituted by phorbol ester and calcium ionophore (Weiss et al., 1984), possibly proceeds through GTP binding protein and phospholipase C. The second step is the downstream events of PKC activation for transmission of the intracellular signals to the nucleus and is likely to involve protein phosphorylation. In this review, we focus on the downwstream events of PKC activa tion for activation of lymphokine genes. To characterize a series of biochemical reactions, we toke several approaches to (1) deflne the regulatory region of the GM-CSF and other lymphokine genes that mediates the response to T cell activation signals or viral transactivators, (2) develop a faithful in vitro transcription system of lymphokine genes which is dependent on regulatory sequence and activation signals, (3) characterize proteins that interact with the regulatory regions, and (4) search for critical target(s) for PKC activation. CLEl CLE2 GC box GGCCAGGAGATTCCACAACTCAGGTAGTTCCCCCGCCCCCCTGGAGTTCTGTGG -72 -60 -113 -96 -84 GGAGATTCCCC IL-2R (p55) . . ."


Best Sellers



Product Details
  • ISBN-13: 9783642741999
  • Publisher: Springer-Verlag Berlin and Heidelberg GmbH & Co. KG
  • Binding: Paperback
  • Height: 242 mm
  • No of Pages: 477
  • Series Title: NATO Asi Subseries H:
  • Weight: 829 gr
  • ISBN-10: 3642741991
  • Publisher Date: 22 Nov 2011
  • Edition: Softcover reprint of the original 1st ed. 1989
  • Language: English
  • Returnable: Y
  • Spine Width: 27 mm
  • Width: 174 mm


Similar Products

Add Photo
Add Photo

Customer Reviews

REVIEWS      0     
Click Here To Be The First to Review this Product
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Springer-Verlag Berlin and Heidelberg GmbH & Co. KG -
Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation
Writing guidlines
We want to publish your review, so please:
  • keep your review on the product. Review's that defame author's character will be rejected.
  • Keep your review focused on the product.
  • Avoid writing about customer service. contact us instead if you have issue requiring immediate attention.
  • Refrain from mentioning competitors or the specific price you paid for the product.
  • Do not include any personally identifiable information, such as full names.

Vectors as Tools for the Study of Normal and Abnormal Growth and Differentiation

Required fields are marked with *

Review Title*
Review
    Add Photo Add up to 6 photos
    Would you recommend this product to a friend?
    Tag this Book Read more
    Does your review contain spoilers?
    What type of reader best describes you?
    I agree to the terms & conditions
    You may receive emails regarding this submission. Any emails will include the ability to opt-out of future communications.

    CUSTOMER RATINGS AND REVIEWS AND QUESTIONS AND ANSWERS TERMS OF USE

    These Terms of Use govern your conduct associated with the Customer Ratings and Reviews and/or Questions and Answers service offered by Bookswagon (the "CRR Service").


    By submitting any content to Bookswagon, you guarantee that:
    • You are the sole author and owner of the intellectual property rights in the content;
    • All "moral rights" that you may have in such content have been voluntarily waived by you;
    • All content that you post is accurate;
    • You are at least 13 years old;
    • Use of the content you supply does not violate these Terms of Use and will not cause injury to any person or entity.
    You further agree that you may not submit any content:
    • That is known by you to be false, inaccurate or misleading;
    • That infringes any third party's copyright, patent, trademark, trade secret or other proprietary rights or rights of publicity or privacy;
    • That violates any law, statute, ordinance or regulation (including, but not limited to, those governing, consumer protection, unfair competition, anti-discrimination or false advertising);
    • That is, or may reasonably be considered to be, defamatory, libelous, hateful, racially or religiously biased or offensive, unlawfully threatening or unlawfully harassing to any individual, partnership or corporation;
    • For which you were compensated or granted any consideration by any unapproved third party;
    • That includes any information that references other websites, addresses, email addresses, contact information or phone numbers;
    • That contains any computer viruses, worms or other potentially damaging computer programs or files.
    You agree to indemnify and hold Bookswagon (and its officers, directors, agents, subsidiaries, joint ventures, employees and third-party service providers, including but not limited to Bazaarvoice, Inc.), harmless from all claims, demands, and damages (actual and consequential) of every kind and nature, known and unknown including reasonable attorneys' fees, arising out of a breach of your representations and warranties set forth above, or your violation of any law or the rights of a third party.


    For any content that you submit, you grant Bookswagon a perpetual, irrevocable, royalty-free, transferable right and license to use, copy, modify, delete in its entirety, adapt, publish, translate, create derivative works from and/or sell, transfer, and/or distribute such content and/or incorporate such content into any form, medium or technology throughout the world without compensation to you. Additionally,  Bookswagon may transfer or share any personal information that you submit with its third-party service providers, including but not limited to Bazaarvoice, Inc. in accordance with  Privacy Policy


    All content that you submit may be used at Bookswagon's sole discretion. Bookswagon reserves the right to change, condense, withhold publication, remove or delete any content on Bookswagon's website that Bookswagon deems, in its sole discretion, to violate the content guidelines or any other provision of these Terms of Use.  Bookswagon does not guarantee that you will have any recourse through Bookswagon to edit or delete any content you have submitted. Ratings and written comments are generally posted within two to four business days. However, Bookswagon reserves the right to remove or to refuse to post any submission to the extent authorized by law. You acknowledge that you, not Bookswagon, are responsible for the contents of your submission. None of the content that you submit shall be subject to any obligation of confidence on the part of Bookswagon, its agents, subsidiaries, affiliates, partners or third party service providers (including but not limited to Bazaarvoice, Inc.)and their respective directors, officers and employees.

    Accept

    New Arrivals



    Inspired by your browsing history


    Your review has been submitted!

    You've already reviewed this product!